Curiosidades de las sustancias placebo

9 octubre 2011

En este vídeo se explica qué son las sustancias placebo pero también está lleno detalles sobre los estudios que se han llevado a cabo con ellas y sus curiosos efectos.

Por resumir para quien no lo sepa: los placebos son «medicina de mentirijillas». Se utilizan en ensayos clínicos para comprobar la efectividad de los medicamentos «de verdad». Hay una buena explicación en el primer capítulo de Escépticos.

Un gran ejemplo de placebo es tal vez el «sana, sana, curita de rana» con el que los padres curan a los pequeños que se caen en el parque. En forma de «medicinas» normalmente son pastillas de «nada», algo así como agua con azúcar. La homeopatía y muchos productos de «efectos mágicos y milagrosos» de venta en farmacias –pulseras energéticas, etcétera– son también básicamente placebos.

Los científicos comenzaron a asombrarse hace tiempo cuando comprobaron en estudios serios que algunos placebos parecen funcionar a veces: basta que la gente crea que una pastilla cura para que –a veces– se curen o al menos mejoren. Naturalmente, el efecto placebo no hace nada para que el problema se resuelva: son todo un truco de nuestro cerebro y nuestro cuerpo, que puede segregar dopamina y otras sustancias por mera sugestión.

Como es lógico, un placebo inerte no puede curar un cáncer, pero para otras dolencias menores o incluso producidas por problemas psicológicos un placebo puede funcionar hasta en el 30 por ciento de las ocasiones – y eso es un porcentaje altísimo: algo totalmente contrario al sentido común y anómalo en la ciencia médica.

Entre la lista de curiosidades que se explican en el vídeo, resulta que en los placebos…

  • Cuanto más grandes son las pastillas, más curan
  • Curan más dos pastillas que una sola…
  • … y las azules curan más que las rojas
  • Los placebos en píldoras curan más que las pastillas…
  • … y las inyecciones curan más que las píldoras
  • También hay pruebas placebo: rayos X, escáneres, etcétera…
  • … Y hasta cirugía placebo

Otro caso que me llamó la atención es que también existen productos placebo para deportistas: toda la gama de tiritas para la narizpulseras del equilibrio, energéticas y similares. Lo increíble: que hay organizaciones que –aun sabiendo que son placebos– pide que sean eliminadas por ser «sustancias dopantes», dado que parecen aumentar el rendimiento de los atletas (!) Es casi como pedir que prohiban dar ánimos antes de un partido o desde la grada. O que prohibieran llevar a los deportistas medallitas con la virgen o una pata de conejo porque no es que les traiga suerte, es que efectivamente funcionan (!)

Sabemos mucho sobre los placebos, pero también hay muchas otras cosas que no sabemos. De hecho están en la lista de 13 cosas que no encajan en el mundo de la ciencia, una recopilación de «misterios» más o menos complejos que por suerte poco a poco la ciencia ha ido desvelando en años recientes – véase como ejemplosolución a la #2.

(Vía Boing Boing.)

(Vía Microsiervos)

Anuncios

Alimentos extraños del mundo

28 abril 2008

La alimentación humana es un hecho cultural. Comemos lo que la sociedad que nos rodea nos ha acostumbrado a comer. Por ello en unas sociedades es normal comer un determinado alimento y en otros lugares ese mismo alimento es considerado asqueroso o incomible.

Con la globalización ya podemos disfrutar de los manjares más exóticos y de los sabores más originales. Y con internet podemos encontrar tiendas que nos venden alimentos que ni por asomo pensábamos que se podían comer.

En esta línea tenemos a Edible una tienda en internet que nos vende insectos, hierbas y especies, afrodisíacos, carnivoros, herbívoros y medicamentos de lo más original para nuestras mentes occidentales.

Como avispa gigante con miel de Japón

O chupachups de gusanos de Mexico

O las hormigas gigantes bañadas con chocolate de Colombia

El vodka de escorpión Chino

Te recogido por monos de China

Y un largo muestrario. Pero creo que como muestra ya tendréis bastante.


Chica protégete a tí misma, pide a tu pareja que use condón

22 julio 2007

Anuncio impactante este de MTV de Portugal

Apoyado por este vídeo

ver vídeo
En el que piden que las chicas se protejan a sí mismas, solicitando a sus parejas que lleven condón para no contagiarse el SIDA.

Llamar la atención la llama el anuncio


via adsoftheworld


Contra la anorexia

17 julio 2007

Este vídeo suizo es una campaña contra la anorexia. Y está indicado para todos aquellas/os que se miran al espejo mirándose los “michelines” y se ven gordos, cuando en realidad no es así, es algo que su mente le indica. Puede estar a un paso de esta enfermedad , o estar dentro de ella. Muy Preocupante.

ver vídeo


Gene2Music – Convirtiendo código genético en música

4 julio 2007

El proyecto realizado por Rie Takahashi y Jeffrey Miller de la universidad de UCLA llamado gene2music convierte el código genético humano en una partitura musical.

Por ejemplo aquí tenéis la “música” creada con la proteína Huntingtin (la proteína parece desempeñar un papel crítico en los acontecimientos
que ayudan a las células nerviosas a funcionar efectivamente)


Se pueden escuchar y ver más ejemplos en la web del proyecto, así como conocer cómo asignan las notas a cada aminoácido y el ritmo desde su página, y hasta mandando una secuencia de genética (

ATGCCTGTGGCCGGCTCGGAGCTGCCGCGCCGGCCCTTGCCCCCCGCCGCACAG) y ver que pasaGAGCGGGACGCCGAGCCG

Vídeos de la disección de un cadaver

2 julio 2007

La Universidad de Wisconsin Medical School ha realizado y colgado 27 vídeos en los que podemos seguir la disección de un cadáver con sus explicaciones pertinentes (en inglés).

Muy interesantes como vídeos educativos para los estudiantes de medicina, pero …  si realmente no estás interesado en la medicina mejor que ni los veas ni te acerques a ellos, puesto que son extríctamente médicos y las imágenes pueden ser poco nada agradables.

Repito, si no estáis interesados en la medicina haced como que no habéis visto este post. Ahora, si estáis estudiando medicina guardaros el link, os puede ayudar en vuestro estudio.


Corazones de oro para comer

21 junio 2007

Un empleado de la compañía Tsukioka exhibe pedazos comestibles en forma de corazón de oro en su lengua en el vigésimo Interphex, la exposición farmacéutica más grande de la industria de Japón, realizada en Tokio el 20 de junio de 2007. Según la compañía, el oro comestible ayuda a restaurar el cuerpo humano.